Methods for producing modified glycoproteins

专利摘要:
The present invention is directed to a cell line having a genetically modified glycoprotein pathway that enables the cell line to carry out a series of enzymatic reactions that mimic the processing of glycoproteins in humans. Recombinant proteins expressed in these engineered hosts yield more similar glycoproteins if they are not substantially identical to their corresponding phosphorous glycoproteins. Lower eukaryotic organisms, including unicellular and multicellular fungi, which normally produce N-glycans with high mannose content, are modified to produce N-glycans or other structures such as Man 5 GlcNAc 2 along the human glycosylation pathway. . This is obtained using a combination of manipulation and / or selection of strains, which strains do not express specific enzymes that produce undesirable complex structures characteristic of fungal glycoproteins, and under conditions present in fungi where activity is desired A strain that expresses or combines selected exogenous enzymes targeted to an organ that possesses optimal activity or that is attained with optimal activity, wherein the genetically engineered eukaryotic organism contains a number of exogenous enzymes required to prepare a "human-like" glycoprotein. Expression.
公开号:KR20030031503A
申请号:KR1020027017911
申请日:2001-06-27
公开日:2003-04-21
发明作者:유. 게른그로스틸만
申请人:글리코파이, 인크.；
IPC主号:

专利说明:

METHODS FOR PRODUCING MODIFIED GLYCOPROTEINS}
[4] Glycosylation Pathway
[5] De novo synthesized proteins can be further processed intracellularly, which is known as post-translational modification. Specifically, sugar residues can be added enzymatically, a process known as glycosylation. Product proteins bearing covalently linked oligosaccharide side chains are known as glycosylated proteins or glycoproteins. Bacteria typically do not glycosylate proteins; When glycosylation occurs, it usually occurs at non-specific positions within the protein. See Moens and Vanderleyden, Arch. Microbiol. 1997 168 (3): 169-175.
[6] Eukaryotic organisms generally attach specific oligosaccharides to the side chains of asparagine in protein asparagine residues, specifically the sequence Asn-Xaa-Ser / Thr / Cys, where Xaa is any amino acid. After attachment of the saccharide moiety known as N-glycans, further modifications may occur in vivo. Typically these modifications occur by an ordered enzymatic reaction known as cascade. Other organisms provide different glycosylation enzymes (glycosyltransferases and glycosidase) and different glycosyl substrates so that the final composition of sugar side chains varies significantly from host to host.
[7] For example, microorganisms such as filamentous fungi and yeast (lower eukaryotes) with hyphae typically add additional mannose and / or mannosylphosphate sugars. The resulting glycans are known as "advanced-mannose" type or mannans. In contrast, in animal cells, the newborn oligosaccharide side chains are cleaved to remove some mannose residues and elongate with additional sugar residues that do not typically occur in N-glycans of lower eukaryotes. Bretthauer et al., Biotechnology and Applied Biochemistry, 1999, 30, 193-200; W. Martinet et al., Biotechnology Letters, 1998, 20, 1171-1177; S. Weikert et al., Nature Biotechnology, 1999, 17, 1116-1121; M. Malissard et al., Biochemical and Biophysical Research Communications, 2000, 267, 169-173; Jarvis et al., 1998 Engineering N-glycosylation pathways in the baculovirus-insect cell systems, Current Opinion in Biotechnology, 9: 528-533; And M. Takeuchi, 1997 Trends in Glycoscience and Glycotechnology, 1997, 9, S29-S35].
[8] N-glycans produced in humans and animals are collectively referred to as complex N-glycans. Complex N-glycans refer to structures having a sialactosamine sequence that is typically linked to 2 to 6 outer branches and an inner core structure, Man ₃ GlcNAc ₂ . The complex N-glycan has one or more branches, preferably two or more branches, and is a structure in which GlcNAc and GlcNAc alternate in terminating oligosaccharides such as: NeuNAc-; NeuAcα2-6GalNAcα1-; NeuAcα2-3Galβ1-3GalNAcα1-; NeuAcα2-3 / 6Galβ1-4GalNAcβ1-; GlcNAcα1-4Galβ1- (only mucin); Fucα1-2Galβ1- (blood group H). Sulfate esters occur at galactose, GalNAc and GlaNAc residues, and phosphate esters occur at mannose residues. NeuAc (Neu: neuramic acid; Ac: acetyl) is replaced by NeuGl (N-glycolylneuraminic acid) or O-acetylated. Complex N-glycans may also carry in-chain substitutions of biogenic GlcNAc and core fucose (Fuc).
[9] Human glycosylation initiates a sequence of ordered reactions from the endoplasmic reticulum (ER) to the core oligosaccharide structure, which is directed to de novo synthesized proteins at asparagine residues in the sequence Asn-Xaa-Ser / Thr (FIG. 1A). Delivered. Further processing by glucosidase and mannosidase occurs in the ER before the newborn glycoprotein is delivered to the initial Golgi apparatus, where additional mannose residues are removed by Golgi-specific 1,2-mannosidase. do. Processing continues as the protein progresses through the Golgi. Many modified enzymes, including N-acetylglucosamine transferases (GnT I, GnT II, GnT III, GnT IV, GnT V, GnT VI), mannosidase II, fucosyltransferases in the middle Golgi, have specific sugar residues. Add and remove (FIG. 1B). Finally in trans Golgi, N-glycans act on galactosyl transferase and sialyltransferase (ST), and the finished glycoprotein is released from the ring device. Protein N-glycans of animal glycoproteins have a 2-, 3- or 4-antenna structure, and may typically include galactose, fucose and N-acetylglucosamine. Typically the terminal residues of N-glycans consist of sialic acid. A typical structure of human N-glycans is shown in FIG. 1B.
[10] Sugar nucleotide precursors
[11] N-glycans of animal glycoproteins typically include galactose, fucose, and terminal sialic acid. These sugars are generally not found in glycoproteins produced in yeast and filamentous fungi. In humans, full-length nucleotide sugar precursors (eg, UDP-N-acetylglucosamine, UDP-N-acetylgalactosamine, CMP-N-acetylneuraminic acid, UDP-galactose, GDP-fucose, etc.) are generally Is synthesized in the cytoplasm and transported into the Golgi, where they are attached to the core oligosaccharides by glycosyltransferases. Sommers and Hirschberg, 1981, J. Cell Biol. 91 (2): A406-A406; Sommers and Hieschberg, 1982 J. Biol. Chem. 257 (18): 811-817; Perez and Hirschberg 1987 Mrthods in Enzymology 138: 709-715.
[12] The glycosyl transfer reaction produces a byproduct that is typically nucleoside diphosphate or monophosphate. Monophosphate can be released directly by exchange with nucleoside triphosphate sugars by an antiport mechanism, but diphosphonucleosides (eg GDP) are not released before phosphatase (eg GDPase) Must be cleaved to produce nucleoside monophosphate and inorganic phosphate. This reaction is important for efficient glycosylation; For example, S. GDPase derived from cerevises has been identified as necessary for mannosylation. However, GDPase shows a 90% reduced activity against UDP. Berninsone et al., 1994, J. Biol. Chem. 269 (1): 207-211α]. Lower eukaryotes typically lack UDP-specific diphosphatase activity in the Golgi apparatus because they do not use UDP-sugar precursors for Golgi-based glycoprotein synthesis. The yeast Schizosaccaromyces pombe , a yeast found to add galactose residues (from UDP-galactose) to cell wall polysaccharides, has been found to possess particularly UDPase activity, which is a need for such enzymes. (Berninsone et al., 1994). UDP is known to be a potent inhibitor of glycosyltransferase, and the removal of this glycosylation byproduct is important to prevent glycosyltransferase inhibition in the lumen of Golgi (Khatara et al., 1994). Berninsone, P. et al. , 1995, J. Biol. Chem. 270 (24): 14564-14567; Beaudet, L. et al., 1998, Abc Transporters: Biochemical, Cellular and Molecular Aspects. 292: 397-413.
[13] Compartmentalization of Glycosylation Enzymes
[14] Glycosyltransferases and mannosidases lining the inner surfaces (luminoscopy) of the ER and Golgi devices provide a catalytic surface that allows for the orderly processing of glycoproteins as they are processed through the ER and Golgi networks. Multiple compartments of the cis, intermediate and trans Golgi and trans Golgi networks (TGN) provide different locations where a certain sequence of glycosylation reactions can occur. Because glycoproteins are processed from synthesis in ER to complete maturation in late Golgi or TGN, they are sequentially exposed to different glycosidase, mannosidase, and glycosyltransferases, thereby providing specific N-glycan structure. Can be synthesized. The enzymes typically comprise a catalytic domain, a stem region, a membrane stratification region and an N-terminal cytoplasmic tail. The latter three structural components allow the glycosylation enzyme to be directed to the appropriate position.
[15] The order of localization from one organism can also function in other organisms. For example, the membrane straddling region of α-2,6-sialyltransferase (α-2,6-ST), an enzyme known to localize in rat trans Golgi, derived from rats, is a reporter in yeast Golgi It has been shown to localize genes (invertases) (Schwientek et al., 1995). However, a membrane stratification region that is very identical to a portion of the full length α-2,6-sialyltransferase is retained in the ER and no longer transported into the Golgi of yeast (Krezdom et al., 1994). Full-length GalT derived from humans is not even synthesized in yeast despite the arguably high levels of transcription. On the other hand, the dural region of the same human GalT fused to an invertase reporter is localized directly into the yeast Golgi, although its production level is low. Schwientek and its co-workers found that 28 amino acids of yeast mannosyltransferase (Mnt1) fused to the catalytic domain of human GalT, 8 amino acids of N-terminal cytoplasmic tail, dural and stem regions, for Golgi localization of active GalT Enough was confirmed (see Schwientek et al., 1995 J. Biol. Chem. 270 (10): 5483-5489]. Other galactosyltransferases are thought to depend on the interaction with enzymes in certain organs, since after removal of their dural regions, they can still be properly localized.
[16] Improper localization of glycosylation enzymes can interfere with the proper action of the enzymes in this pathway. For example, Aspergillus nidulans carrying a large number of α-1,2-mannosidases (Eades and Hintz, 2000, Gene 255 (1): 25-34) are transfected with rabbit GnT I genes. It does not add GlcNAc to Man ₅ GlcNAc ₂ despite overall high levels of GnT I activity at the time of conversion (Kalsner et al., 1995). Despite being actively expressed, GnT I is not correctly localized so that the enzyme may not be in contact with its substrate, ie the newborn N-glycans and UDP-GlcNAc of glycoproteins. Alternatively, the host organism may not provide adequate levels of UDP-GlcNAc in the Golgi.
[17] Therapeutic Glycoproteins Used
[18] Many of the proteins isolated from humans or other animals are glycosylated. About 70% of the therapeutically used proteins are glycosylated. However, when a therapeutic protein is produced in a microorganism such as yeast and glycosylated using an inherent route, its therapeutic effectiveness is typically greatly reduced. Such glycoproteins are typically immunogenic in humans and show reduced lifespan in vivo after administration (Takeuchi, 1997).
[19] In humans and animals specific receptors recognize terminal mannose residues and promote rapid clearance of proteins from the bloodstream. Other adverse effects may include changes in protein folding, solubility, susceptibility to proteases, trafficking, transport, compartmentalization, secretion, recognition by other proteins or factors, antigenic or allergenic. Thus, it was necessary to produce therapeutic glycoproteins in animal host systems to make the glycosylation pattern identical or at least similar to that in human or intended receptor species. In most cases mammalian host systems are used, for example mammalian cell culture.
[20] Therapeutic Glycoprotein Generation System
[21] Animal or plant-based expression systems have been used to produce therapeutic proteins with suitable glycoforms and with satisfactory therapeutic effects. Available systems are as follows:
[22] 1. Chinese hamster egg cells (CHO), mouse fibroblasts and mouse myeloma cells [Arzneimittelforschung. 1988. 8; 48 (8): 870-880]
[23] 2. Transgenic animals such as goats, sheep, mice and others [Dente Prog. Clin. Biol. 1989 Res. 300: 85-98, Ruther et al., 1988 Journal 53 (6): 847-856; Ware, J. et al., 1993 Thrombosis and Haemostasis 69 (6): 1194-1194; Cole, E. S. et al., 1994, J. Cell. Biochem. 265-265]
[24] 3. Plants ( Arabidopsis thaliana , Tobacco, etc.) (Staub et al., 2000, Nature Biotechnology 18 (3): 333-338) (McGarvey, PB et al., 1995, BioTechnology 13 (13): Bardon, M. et al., 1999 Trends in Plant Scince 4 (9): 376-380;
[25] 4. Insect cells ( Spodoptera frugiperda Sf9, Sf21, Trichoplusia ni , etc., such as autografpa californica, which infects recombinant baculoviruses, eg, Lepidopteran serovars ). Autographa californica multinuclear polyhedrosis virus (Altmans et al., 1999 Glycoconj. J. 16 (2): 109-123).
[26] Recombinant human proteins expressed in the host system may still comprise non-human glycoforms. See Raju et al., 2000 Annals Biochem. 283 (2): 123-132]. Specifically, the fraction of N-glycans lacks terminal sialic acid typically found in human glycoproteins. Substantial efforts have been focused on the development process to obtain glycoproteins that are as structurally as possible in human form and have similar structures or other therapeutic advantages. Glycoproteins bearing certain glycoforms are particularly useful, for example, in the targeting of therapeutic proteins. For example, the addition of one or more sialic acid residues to glycans can increase the lifespan of a therapeutic glycoprotein in vivo after administration. Thus, mammalian host cells can be genetically engineered to increase the amount of terminal sialic acid in the glycoprotein expressed in the cell. Alternatively, sialic acid can be conjugated to a given protein in vitro using sialic acid transferase and a suitable substrate prior to administration. In addition, changes in growth medium composition or changes in expression of enzymes involved in human glycosylation can be used to generate more similar human forms of glycoproteins. See S. Weikert et al., Nature Biotechnology, 1999, 17, 1116. -1121; Werner, Noe et al., 1999; Andersen and Goochee 1994 Cur. Opin. Biotechnol. Bioengin. 68 (4): 370-380]. Alternatively, cultured human cells may be used.
[27] However, all existing systems have serious drawbacks. Only certain therapeutic proteins are suitable for expression in animal or plant systems (eg lacking any cytotoxic or other effects detrimental to growth). Animal and plant cell culture systems are generally very slow and may require more than a week to produce any effective amount of a given protein under carefully controlled conditions. Nevertheless, the protein yield is not compared with the yield obtained through the microbial fermentation process. In addition, cell culture systems generally require complex and expensive nutrients and cofactors such as fetal bovine serum. In addition, growth can be limited by programmed cell death (apoptosis).
[28] In addition, animal cells (particularly mammalian cells) are very sensitive to viral infection or contamination. In some cases, viruses or other infectious agents may impair the growth of the culture, while in other cases the agents may be human pathogens making the therapeutic protein unsuitable for intended use. In addition, many cell culture processes are complex, temperature sensitive, and may require the use of animal-derived growth medium components, which may carry pathogens such as bovine spongiform encephalopathy (BSE) prions. Such pathogens are difficult to detect and / or difficult to remove or sterilize without damaging the growth medium. In any case, the use of animal cells to produce therapeutic proteins requires expensive quality control to ensure product stability.
[29] In addition, transgenic animals can be used to prepare large amounts of therapeutic proteins such as human serum albumin, tissue plasminogen activators, monoclonal antibodies, hemoglobin, collagen, fibrinogen and other substances. Transgenic goats and other transgenic animals (mouse, sheep, cattle, etc.) can be genetically engineered to produce high levels of therapeutic protein in milk, but this process is costly because all batches must perform strict quality control. It costs a lot Animals can host various animal or human pathogens such as bacteria, viruses, fungi and prions. In the case of scrapie and bovine spongiform encephalopathy, the test may be performed over about a year to rule out infection. Thus, the production of therapeutic compounds is preferably carried out in a well controlled sterile environment, for example Good Manufactiring Practice (GMP) conditions. In general, however, it is impossible to keep animals in such an environment. In addition, cells grown in fermenters are derived from one well-characterized Master Cell Bank (MCB), while transgenic animal techniques rely on different animals and are therefore not uniform in nature. In addition, external factors such as different nutrient uptake, disease and lack of homogeneity in the herd can affect the glycosylation pattern of the final product. For example, different dietary habits in humans are known to cause different glycosylation patterns.
[30] Transgenic plants have been developed as potential sources for obtaining proteins of therapeutic value. However, very high levels of expression in plants are subject to gene silencing (the mechanism by which genes for highly expressed proteins are down regulated in subsequent plant generations). Plants also add xylose and / or α-1,3-linked fucose to the protein N-glycan to produce glycoproteins of different structure than in animals, which are immunogenic in animals. , Marz et al., 1995, Glycoconj. J. 12 (2); 150-155]. In addition, growing plants in a sterile environment or in a GMP environment is generally not practical, and recovery of protein from plant tissue is more expensive than recovery from fermented microorganisms.
[31] Production of Glycoproteins Using Eukaryotic Microbes
[32] Thus, the lack of a suitable expression system is a serious obstacle to the safe and low cost production of recombinant human glycoproteins. The production of glycoproteins through the fermentation of microorganisms provides a number of advantages over existing systems. For example, the production of protein through fermentation
[33] (a) rapid production of high concentration proteins;
[34] (b) sterile and can use well controlled production conditions (eg, GMP conditions);
[35] (c) simple, chemically defined growth media can be used;
[36] (d) genetic engineering is easy;
[37] (e) there is no infection of human or animal pathogens;
[38] (f) can express various kinds of proteins, for example, proteins that are poorly expressed in cell culture due to toxicity, etc .;
[39] (g) Easy protein recovery (e.g. secretion into the medium)
[40] Provides an advantage. In addition, fermentation plants can generally be constructed at lower cost than cell culture plants.
[41] However, as noted above, bacteria that include species such as Escherichia coli, which are typically used to produce recombinant proteins, do not glycosylate proteins in certain ways, such as eukaryotes. Various methyltropic enzymes, such as Pchia pastoris, Pchia methanolica and Hansenula polymorpha , are particularly useful as eukaryotic expression systems because they can grow to high cell densities and / or This is because a large amount of recombinant protein can be secreted. However, as noted above, glycoproteins expressed in these eukaryotic microorganisms are substantially different in N-glycan structure than those expressed in animals. This hinders the use of yeast or filamentous fungi as a host for the production of many useful glycoproteins.
[42] Several efforts have been made to alter the glycosylation pathway of eukaryotic microorganisms to provide glycoproteins more suitable for use as mammalian therapeutics. For example, some glycosyltransferases are cloned separately and It has been expressed in cerevises (GalT, GnT I), Aspergillus nidulans (GnT I) and other fungi [Yoshida et al., 1999, Kalsner et al., 1995 Glycoconj. J. 12 (3): 360-370, Schwientek et al., 1995]. However, N-glycans with human characteristics were not obtained.
[43] Yeast is characterized by a variety of mannosyltransferases, for example 1,3-mannosyltransferase (eg, MNN1 in S. cerevises) [Graham and Emr, 1991, J. Cell. Biol. 114 (2): 207-218], 1,2-mannosyltransferase (e.g., KTR / KRE papili derived from S. cerevises), 1,6-mannosyltransferase (S. cerevises OCH1 derived from, mannosylphosphate transferase (MNN4 and MNN6 derived from S. cerevises) and additional enzymes involved in endogenous glycosylation reactions. Many of these genes are individually deleted resulting in viable organisms with altered glycosylation profiles. Examples are shown in Table 1 below.
[44] Examples of Yeast Strains with Altered Mannosylation Strain N-glycan (wild type) Mutation N-glycan (mutated) Reference s. Pomb Man _{> 9} GlcNAc ₂ OCH1 Man ₈ GlcNAc ₂ Yoko-o et al., 2001 FEBS Lett. 489 (1): 75-80 s. Cerebize Man _{> 9} GlcNAc ₂ OCH1 / MAN1 Man ₈ GlcNAc ₂ Nakanishi-Shindo et al., 1993 J. Biol. Chem. 268 (35): 26338-26345 s. Cerebize Man _{> 9} GlcNAc ₂ OCH1 / MNN1 / MNN4 Man ₈ GlcNAc ₂ Chiba et al., 1998 J. Biol. Chem. 273, 26298-26304
[45] In addition, Japanese Patent Application Publication No. 8-336387 discloses an OCH1 mutant strain of Pchia pastoris. To OCH1 gene encoding the transferase nosil only 1,6, the enzyme was added to the nose, only the glycan structure Man ₈ GlcNAc ₂ to produce the Man ₉ GlcNAc _2. The Man ₉ GlcNAc ₂ structure is then a substrate for further mannosylation in vivo and produces an overmannosylated glycoprotein that is characteristic of yeast, which is typically at least 30-40 mannose residues per N-glycan. Can hold. In OCH1 mutant strains, proteins glycosylated with Man ₈ GlcNAc ₂ are not substrates for animal glycosylation enzymes, eg, human UDP-GlcNAc transferase I, and thus the method produces proteins with human glycosylation patterns. Not useful
[46] See Martinet et al., Biotechnol. Lett. 1988, 20 (12), 1171-1177]. Expression of α-1,2-mannosidase from Trichoderma reesei in Pastoris has been reported. Several mannose cleaved from the N-glycans of the model protein was observed. However, the model protein did not have an N-glycan bearing the Man ₅ GlcNAc ₂ structure, which is an intermediate for the production of complex N-glycans. Thus, the method is not useful for producing proteins with human or animal glycosylation patterns.
[47] Similarly, Chiba et al. (1998) expressed α-1,2-mannosidase from Aspergillus cytokines in yeast Saccharomyces cerevises. A single peptide sequence (His-Asp-Glu-Leu) was engineered with exogenous mannosidase to promote retention in ER. In addition, the yeast host has three enzymatic activities related to the overmannosylation of the protein: 1,6-mannosyltransferase (OCH1), 1,3-mannosyltransferase (MNN1) and mannosylphosphate transferase (MNN4) Mutants lacking enzyme activity. Thus, the N-glycans of the triple mutant host are wild-type S. aureus. It is composed of the Man ₈ GlcNAc ₂ structure rather than the high mannose form identified in cerevises. In the presence of the engineered mannosidase, the N-glycans of the model protein (carboxypeptidase Y) were cleaved to 27 mol% Man ₅ GlcNAc ₂ , 22 mol% Man ₆ GlcNAc ₂ , 22 mol% Man ₇ A mixture consisting of GlcNAc ₂ , and 29 mol% Man ₈ GlcNAc ₂ is produced. Cleavage of endogenous cell wall glycoproteins is less efficient and only contains 10 mole percent of N-glycans with the desired Man ₅ GlcNAc ₂ .
[48] Since only Man ₅ GlcNAc ₂ glycans are sensitive to further enzymatic conversion to human glycoforms, this method is not efficient for the production of proteins bearing human glycosylation patterns. In proteins that possess a single N-glycosylation site, at least 73 mole percent have inadequate structure. In proteins having two or three N-glycosylation sites, at least 93 mol% or 98 mol%, respectively, have inappropriate structures. Such low conversion efficiencies are not satisfactory for the production of therapeutic agents, especially since the separation of proteins with different glycoforms is expensive and difficult.
[49] For the purpose of providing more human-like glycoproteins derived from fungal hosts, US Pat. No. 5,834,251 (Maras and Contreras) provides a method for producing hybrid glycoproteins derived from Trichoderma assays. Hybrid N-glycans have only one mannose residue on the Manα1-6 arm of the core and one or two composite antennas on the Manα1-3 arm. While this structure is useful, the method has the disadvantage that many enzyme processing steps that must be performed in vitro are expensive and time consuming. Isolated enzymes are expensive to manufacture and maintain, may require unusual and expensive substrates (eg, UDP-GlcNAc), and are prone to loss of activity and / or proteolysis under conditions of use. have.
[50] Accordingly, it is an object of the present invention to provide Pchia pastoris and other lower eukaryotes, such as Hanshenula polymorpha, Pchia spistitis, Pchia methanolica, Pchia, Cluyberomyces sp., Candida albicans, Provided are methods for humanizing glycosylation of recombinant glycoproteins expressed in Aspergillus nidulans and Trichoderma assays.
[1] Related Applications
[2] This application is a priority claims application of US Provisional Application Nos. 60 / 214,358 (June 28, 2000), 60 / 215,638 (June 30, 2000) and 60 / 279,997 (March 30, 2001).
[3] The present invention provides fungi that can be genetically modified to produce glycosylated proteins (glycoproteins) that have a glycosylation pattern similar to glycoproteins produced by animal cells, especially human cells, useful as human or animal therapeutics, or The present invention relates to a method for producing a modified glycoprotein by other eukaryotic microorganisms and to a produced glycoprotein.
[56] 1A is a schematic of a typical fungus N-glycosylation pathway.
[57] 1B is a schematic of a typical human N-glycosylation pathway.
[58] Detailed description of the invention
[59] The methods and recombinant lower eukaryotic strains described herein were used to make "humanized glycoproteins." Recombinant lower eukaryotes were prepared by engineering lower eukaryotes that do not express one or more enzymes involved in the production of high mannose constructs to express the enzymes needed to produce humanized sugars. As used herein, the term “lower progression organism” is a single cell strain or a filamentous strain. As used herein, the term “humanized glycoprotein” refers to N-glycans attached thereto comprising less than 4 mannose residues, and synthetic intermediates having 5 or more mannose residues (useful and additional in vitro). Protein, which can be engineered). In a preferred embodiment, the glycoproteins produced in recombinant lower eukaryotes contain at least 27 mol% Man5 intermediates. This is obtained by cloning into a better mannosidase, ie, an enzyme selected to retain optimal activity under conditions present in the organism at the location where the protein is glycosylated, or by targeting the enzyme to an organ in need of activity.
[60] In a preferred embodiment, eukaryotic strains that do not express one or more enzymes involved in producing a high mannose construct are used. These strains may be engineered or one of a number of mutants already described in yeast, including overmanosylation-free (OCH1) mutants in Pchia pastoris.
[61] The strains can be engineered to produce a library of genes encoding one enzyme or potentially useful enzymes at one time, and those strains containing the enzyme with optimal activity or producing the most "humanoid" glycoprotein are selected.
[62] Lower eukaryotes that can produce glycoproteins with attached N-glycan Man ₅ GlcNAc ₂ are particularly useful because: (a) they lack a high degree of mannosylation (eg, N At least 8 mannose per glycan, or in particular 30-40 mannose), exhibiting reduced immunogenicity in humans; (b) N-glycans are substrates for further glycosylation reactions to form even more humanoid glycoforms, eg, GlcNAcMan ₅ GlcNAc ₂ by the action of GlcNAc transferase I. Man ₅ GlcNAc ₂ must be formed at least temporarily in high yield in vivo because all subsequent glycosylation reactions require Man ₅ GlcNAc ₂ or derivatives thereof. Thus, a yield in which a high proportion of N-glycans has a Man ₅ GlcNAc ₂ is obtained at 27 mol% or more, more preferably 50 to 100 mol% or more. Further glycosylation reactions are then carried out in vitro using, for example, the method of US Pat. No. 5,834,251 (Maras and Contreras). In a preferred embodiment, one or more additional glycosylation reactions are performed in vivo. In a very preferred embodiment thereof, the cleavage of the glycosylation enzyme is expressed in the endoplasmic reticulum and / or Golgi apparatus.
[63] Host microorganism
[64] Both yeast and filamentous fungi have been used successfully for the production of endogenous and secreted recombinant proteins [Cerehino, J. L. and J. M. Cregg 2000 FEMS Microbiology Reviews 24 (1): 45-66; Harkki, A. et al., 1989 Bio-Technology 7 (6): 596; Berka, R. M. et al., 1992 Abstr. Papers Amer. Chem. Soc. 203: 121-BIOT; Svetina, M. et al., 2000 J. Biotechnol. 76 (2-3): 245-251].
[65] Although glycosylation in yeasts and fungi is very different from that in humans, there are some commonalities shared with each other. Delivery of the core oligosaccharide structure to the first step, the neonatal protein, is highly conserved in all eukaryotes, including yeasts, fungi, plants and humans (compare Figures 1A and 1B). However, subsequent processing of the core oligosaccharides is markedly different in enzymes and involves the addition of some mannose sugars. This step is catalyzed by mannosyltransferases (eg, OCH1, MNT1, MNN1, etc.) in the Golgi that add several mannose sugars to the core oligosaccharides in a given order. The resulting structure is undesirable for the production of human proteins and therefore is required to reduce or eliminate mannosyltransferase activity. S lacking mannosyltransferase activity. The mutant of cerevises (och1 or mnn9 mutant) is non-fatal and reduces mannose content in oligosaccharides in yeast glycoproteins. Other oligosaccharide processing enzymes such as mannosylphosphate transferase may also need to be removed depending on the host's specific endogenous glycosylation pattern. After reducing the undesirable endogenous glycosylation reaction, the host system must be engineered to form complex N-glycans. This is necessary for stable expression of some enzymes and sugar-nucleotide transporters. In addition, these enzymes must be located in a manner that ensures processing according to a predetermined sequence of mature glycosylation structures.
[66] Target glycosylation
[67] The methods described herein are useful for producing glycoproteins, specifically glycoproteins used therapeutically in humans. Such therapeutic proteins are typically administered by injection, oral administration, pulmonary administration or other modes of administration.
[68] Examples of suitable target glycoproteins include erythropoietin, cytokines (eg, interferon-α, interferon-β, interferon-γ, interferon-ω, and granulocyte-CSF), aggregation factors (eg, factor VIII, Factor IX, and human protein C), soluble IgE receptor α-chain, IgG, IgM, urokinase, kinase and urea trypsin inhibitor, IGF-binding protein, endothelial growth factor, growth hormone releasing factor, annexin V fusion protein, Anne Geostatin, vascular endothelial growth factor-2, myeloid progenitor inhibitor-1, and osteoprotegerin, but are not limited thereto.
[69] N-glycan Man ₅GlcNAc ₂Method for producing a glycoprotein comprising
[70] The first step involves the selection or formation of lower eukaryotes capable of producing specific precursor structures of Man ₅ GlcNAc ₂ that can accept GlcNAc in vivo by the action of GlcNAc transferase I. This step requires the formation of specific isomeric structures of Man ₅ GlcNAc ₂ . This structure must be formed in cells with high yield (greater than 30%) because all subsequent manipulations are subject to the presence of the precursors. However, Man ₅ GlcNAc ₂ constructs are required for complex N-glycan formation, and their presence is never sufficient, because Man ₅ GlcNAc ₂ may or may not function as a substrate for GlcNAc transferase I This is because they can occur with different isomers. Most glycosylation reactions are incomplete, so certain proteins generally contain a range of different carbohydrate structures (ie, sugar forms) on their surface. The presence of only traces (less than 5%) of specific structures such as Man ₅ GlcNAc ₂ has little practical relevance. What is needed is the formation of specific GlcNAc transferase I receptor intermediates (structure I) in high yield (> 30%). Formation of such intermediates is required, which subsequently enables in vivo synthesis of complex N-glycans.
[71] Such lower eukaryotes may be selected from naturally occurring or genetically engineered fungi, or other lower eukaryotes that provide such structures in vivo. There are no lower eukaryotes that have been found to provide this structure in excess of 1.8% of the total N-glycans (Maras et al., 1997), and therefore genetically engineered organisms are preferred. Methods such as those described in US Pat. No. 5,595,900 can be used to identify the presence or absence of specific glycosyltransferases, mannosidases and sugar nucleotide transporters in certain target organics.
[72] Inactivation of fungal glycosylation enzymes such as 1,2-α-mannosidase
[73] A wide range of lower eukaryotes (eg, Hanshenula polymorpha, Peachia squitis, Peachia methanolica, Peachia, Kluyveromyces spp., Candida albicans, As) using the methods described herein Glycosylation patterns of Pergillus nidulans, Trichoderma reese, etc.) can be manipulated. Peachia pastoris are used to illustrate the necessary operating steps. Similar to other lower eukaryotes, blood. Pastoris retains Man ₉ GlcNAc ₂ with 1,2-α-mannosidase in the ER to produce Man ₈ GlcNAc ₂ . Through the action of some mannosyltransferases, this structure is converted into an overmannosylated structure (Man _{> 9} GlcNAc ₂ ) known as mannan. Also, p. Pastoris can add non-terminal phosphate groups to the carbohydrate structure through the action of mannosylphosphate transferases. This corresponds to the response identified in mammals and is associated with the removal of mannose sugars in response to their addition. Of particular importance is the elimination of the fungus' ability to oversylate the existing Man ₈ GlcNAc ₂ structure. This can be achieved by selecting fungi that do not oversylated, or by genetically manipulating these fungi.
[74] The genes involved in this process are blood. It has been identified in Pastoris, and mutations can be made in these genes to reduce the production of "preferred" glycoforms. Such genes may be used in other lower eukaryotes, such as seeds. Albicans, pichia angusta or s. Confirmed by homology to existing mannosyltransferases found in cerevises (eg, OCH1, MNN4, MNN6, MNN1) or selected for phenotypes that cause mutations in host strains and have reduced mannosylation This can be confirmed by. Based on homology, among the known mannosyltransferases and mannosylphosphate transferases, one constructs a PCR primer as shown in Table 2, or designates such an enzyme as a probe for identifying homologs in the DNA library of the target organism. Genes or gene fragments encoding may be used. Alternatively, certain phenotypes can be supplemented in the organisms involved. For example, blood. To obtain a gene or genes encoding 1,6-mannosyltransferase activity in Pastoris, the following steps can be performed. s. The OCH1 mutant of cerevises is temperature sensitive and grows slowly at high temperatures. Thus, blood. S. using Pastoris DNA or cDNA libraries. Blood by supplementing the OCH1 mutant of cerevises. Functional homologues of OCH1 can be identified in Pastoris. Such s. Cervical mutants are available at http://genome-www.stanford.edu/Saccharomyces/ and are sold at http://www.resgen.com/products/YEASTD.php3. blood. After transformation using the Pastoris DNA library, mutant strains exhibiting normal growth phenotypes at high temperatures. Will retain the OCH1 homologue of Pastoris. These libraries can be circulated using suitable restriction enzymes. It can be produced by partially digesting the chromosomal DNA of Pastoris, inactivating restriction enzymes, and then linking the digested DNA into a suitable vector digested with a commercial restriction enzyme. Suitable vectors include pRS314, a low copy (CEN6 / ARS4) plasmid based on pBluescript containing Trp1 markers (Sikorski, RS and Hieter, P. 1989, Genetics 122, pp 19-27) or pFL44S, URA3 markers. High copy (2μ) plasmid based on modified pUC19 containing [Nobbeaud, N. et al., 1991, Yeast 7, pp. 609-615]. Such vectors have been commonly used by academic researchers, or similar vectors have been used by many other manufacturers such as Invitrogen (California, Carlsbad), Pharmacia (Piscataway, New Jersey), and New England Biolabs (Massachusetts Beverly). It is commercially available. Examples include pYES / GS, a replication 2μ origin based on yeast expression plasmids available from Invitrogen, or Yep24 cloning vehicle available from New England Biolabs. After ligation of the chromosomal DNA and the vector, the vector ss the DNA library with a specific mutation. Transformation into the cerevise strain can be made and selected for correction of the corresponding phenotype. After subcloning and sequencing of DNA fragments capable of restoring the wild phenotype, the fragments are used to obtain P. a. Deactivation of the gene product encoded by OCH1 in Pastoris can be eliminated.
[75] Or, if you know the entire genome sequence of a particular fungus of interest, you can simply identify these genes by searching a publicly available DNA database. These databases can use several sources, such as NCBI, Swissport, and so on. For example, S. By using a known 1,6-mannosyltransferase gene (OCH1) derived from cerevises, a given genomic sequence or database is searched for genes having 1,6-mannosyltransferase activity with high certainty. Genes with high homology within this genome, which encodes, can be identified. These genes are S. It has functions similar to genes involved in mannosylation of proteins in cerevises, and therefore their deficiencies are avoided. It can be used to manipulate glycosylation patterns in Pastoris or other fungi with similar glycosylation pathways.
[76] Once a given target gene sequence is determined, the generation of gene knock-out is a well established technique in the field of yeast and fungal molecular biology and can be performed by one skilled in the art. See R. Rothsteins (1991) Methods in Enzymology, vol. 194, p. 281]. Indeed, the choice of host organism can be influenced by the availability of good transformation and gene division techniques for such hosts. If some mannosyltransferases must be knocked out, the method developed by Alani and Klechner allows for the repeat use of the URA3 marker to remove all undesirable endogenous mannosyltransferase activity in a given order. This technique was further developed by other researchers, but involves the use of two repeating DNA sequences adjacent to corresponding selectable markers. For example, URA3 can be used as a marker to ensure selection of transformants incorporating constructs. By bringing the direct repeat and the URA3 markers into close proximity, the transformants that integrate the construct and cleave the target gene can be selected first. After isolation and characterization of the transformants, a corresponding choice may be made for resistance to 5'FOA in the second round. Colonies that can survive on 5'FOA containing plates lose URA3 markers again through crossover events involving the repeats described above. Thus, this method allows for repeated use of the same markers and can easily perform cleavage of multiple genes without requiring additional markers.
[77] blood. The removal of certain mannosyltransferases, such as 1,6-mannosyltransferase (OCH1), mannosylphosphate transferases (genes that supplement MNN4, MNN6 or lbd mutants) in Pastoris is primarily associated with Man ₈ It allows the production of engineered strains of the organisms that synthesize GlcNAc ₂ , thus further modifying glycosylation patterns to more closely mimic more complex human glycoform structures. Preferred embodiments of the method are blood. Genetically altered blood generated using DNA sequences encoding known biochemical glycosylation activity that eliminates similar or identical biochemical functions within Pastoris. Altering the glycosylation structure of pastoris.
[78] PCR primer A PCR primer B blood. Pastoris Targeted Gene (s) Homolog ATGGCGAAGGCAGATGGCAGT TTAGTCCTTCCAACTTCCTTC 1,6-mannosyltransferase OCH1S. Cervizepichia Albicans TAYTGGMGNGTNGARCYNGAYATHAA GCRTCNCCCCANCKYTCRTA 1,2-Mannosyltransferase KTR / KRE Guess. Cerebize Note: M = A or C, R = A or G, W = A or T, S = C or G, Y = C or T, K = G or T, V = A or C or G, H = A or C or T, D = A or G or T, B = C or G or T, N = G or A or T or C.
[79] Incorporation of Mannosidase into Genetically Engineered Hosts
[80] The processes described herein produce these structures in high yield and yield complex N-glycans for modification purposes. Successful schemes for obtaining a suitable Man ₈ GlcNAc ₂ should include two parallel techniques: (1) a method of reducing endogenous mannosyltransferase activity and (2) 1,2-α-mannose by mannosidase. Removing to yield a suitable Man ₈ GlcNAc ₂ structure at high levels. What distinguishes this method from the prior art is that it deals directly with both of these points. As Chiba and its co-workers found, A. ER into ER. By manipulation in the presence of fungus mannosidase derived from cytokines. It is possible to reduce the Man ₈ GlcNAc ₂ structure to the Man ₅ GlcNAc ₂ isomer in cerevises. The method has disadvantages: (1) insufficient amounts of Man ₅ GlcNAc ₂ are formed in the extracellular glycoprotein fraction (10%); (2) It is not clear whether the Man ₅ GlcNAc ₂ structure formed in vivo can actually receive GlcNAc by the action of GlcNAc transferase I. If several glycosylation sites are present in the target protein, the probability (P) of obtaining these proteins in the correct form is P = (F) ⁿ where n is the number of glycosylation sites and F is the fraction of the desired glycoform. According to the relationship Glycoproteins with three glycosylation sites are 0.1% more likely to provide suitable precursors for complex and hybrid N-glycan processing at all of their glycosylation sites, which limits the commercial value of the method.
[81] s. Most enzymes active in the ER and Golgi apparatus of cerevises have values in the range of 6.5 to 7.5 with optimal pH (see Table 3). All previous methods of reducing mannosylation by the action of recombinant mannosidase have been found to reduce the activity of these enzymes to less than 10% at pH 7.0. Pastoris and S. Although they will provide insufficient activity at their point of use, ER and early Golgi, they are concentrated on enzymes with optimal pH around pH 5.0 (Martinet et al., 1998 and Chiba et al., 1998). The preferred process utilizes α-mannosidase in vivo where the optimal pH of the mannosidase is within 1.4 pH units of the average optimal pH of other representative marker enzymes localized in the same organ (s). The optimum pH of an enzyme targeted to a particular organ should correspond to the optimum pH of other enzymes found in the same organ, where the maximum activity per unit enzyme is obtained. Table 3 summarizes the activity of mannosidase from various sources and their optimum pH. Table 4 summarizes their locations.
[82] Mannosidase and Their Optimum pH sauce enzyme Optimal pH Reference Aspergillus Cytoi 1,2-α-mannosidase 5.0 Ichishima et al., 1999, Biochem. J. 339 (Pt3): 589-597 Tricoderma Reise 1,2-α-mannosidase 5.0 Maras et al., 2000 J. Biotechnol. 77 (2-3): 255-263 Penicillium citrine 1,2-α-D-mannosidase 5.0 Yoshida et al., 1993 Biochem. J. 290 (Pt2): 349-354 Aspergillus nidulans 1,2-α-mannosidase 6.0 Eades and Hintz, 2000 Homo sapiens IA (Golgi) 1,2-α-mannosidase 6.0 Homo sapiens IB (Golgi) 1,2-α-mannosidase 6.0 Repiddorfera Insect Cells I type 1,2-α-Man ₆ -mannosidase 6.0 Ren et al., 1995 Biochem. 34 (8): 2489-2495 sapient α-D-mannosidase 6.0 Chandrasekaran et al., 1984 Cancer Res. 44 (9): 4059-68 Xanthomonas Manihortis 1,2,3-α-mannosidase 6.0 Mouse IB (Golgi) 1,2-α-mannosidase 6.5 Schneikert and Herscovics, 1994 Glycobiology. 4 (4): 445-50 Genus Bacillus (secreted) 1,2-α-D-mannosidase 7.0 Maruyama et al., 1994 Carbohydrate Res. 251: 89-98
[83] s. When attempting to cleave a high mannose structure in order to yield Man ₅ GlcNAc ₂ in the ER or Golgi apparatus of cerevises, (1) have a pH sufficiently close to the optimum pH (ie, pH 5.2 to pH 7.8) , Or (2) any or a combination of these enzymes known to produce the specific isomeric Man ₅ GlcNAc ₂ necessary to accommodate subsequent addition of GlcNAc by GnT I, alone or in concert. Any enzyme or combination of enzymes found in vitro to form a structure that can be converted to GlcNAcMan ₅ GlcNAc ₂ by GnT I constitutes an appropriate choice. This knowledge determines whether the scientific literature or potential mannosidase can convert Man ₈ GlcNAc ₂ -PA to Man ₈ GlcNAc ₂ -PA, and the Man ₅ GlcNAc ₂ -PA obtained is then used for GnT I and UDP-GlcNAc. This can be seen experimentally by testing whether it can act as a substrate to produce GlcNAcMan ₅ GlcNAc ₂ in vitro.
[84] 1,2-mannosidase activity in ER and Golgi
[85] Previous methods of reducing mannosylation by the action of cloned exogenous mannosidases yield glycoproteins with sufficient fractions of N-glycans (eg,> 27 mol%) with a Man ₅ GlcNAc ₂ structure. (Martinet et al., 1998 and Chiba et al., 1998). These enzymes must function sufficiently in the ER or Golgi apparatus to be effective at converting neoglycoproteins. While the optimal pH of two conventionally used mannosidases (A. Cytoy and T. Reesei) is 5.0, most of the enzymes that are active in the ER and Golgi apparatus of enzymes (e.g., S. cerevises) Has an optimum pH of 6.5 to 7.5 (see Table 3). Glycosylation of proteins has evolved greatly, and effective processing can be performed at ER and internal pH in the Golgi, in the range of about 6-8. At pH 7.0, the activity of previously used mannosidase is reduced to less than 10%, which is insufficient for efficient production of Man ₅ GlcNAc ₂ in vivo.
[86] s. Cell Location and Optimum pH of Various Glycosylation-related Enzymes of Celebevises gene activation location Optimal pH Author (s) Ktr1α-1,2-mannosyltransferase Golgi 7.0 Romero et al., 1997 Biochem. J. 321 (Pt 2): 289-295 Mns1α-1,2-mannosidase ER 6.5 CWH41Glucosidase I ER 6.8 -Mannosiltransferase Golgi 7-8 Lehele and Tanner, 1974 Biochem. Biophys. Acta 350 (1): 225-235 Kre2α-1,2-mannosyltransferase Golgi 6.5-9.0 Romero et al., 1997
[87] α-1,2-mannosidase enzymes should have optimal activity at pH 5.1 to 8.0. In a preferred embodiment, the optimal activity of the enzyme is shown at pH 5.9 to 7.5. Optimum pH can be determined under in vitro assay conditions. Preferred mannosidases are those which possess the appropriate optimum pH as shown in Table 3, examples of which include Aspergillus nidulans, Homo sapiens IA (Golgi), Homo sapiens IB (Golgi), Lepidopteran insects Cells (IPLB-SF21AE), homo sapiens, mouse IB (Golgi), and Xanthomonas manihotis . In a preferred embodiment, the single cloned mannosidase gene is expressed in the host organism. However, in some cases, it is desirable to express several different mannosidase genes or to express several copies of certain genes to obtain proper production of Man ₅ GlcNAc ₂ . If multiple genes are used, all of the encoded mannosidases should have 5.1 to 8.0 or specifically 5.9 to 7.5 in the optimal pH range. In a particularly preferred embodiment, the mannosidase activity is targeted to ER or cis Golgi, where an initial glycosylation reaction occurs.
[88] Formation of Complex N-Glycans
[89] The second step of the process involves adding sugars in a defined order to the neonatal carbohydrate structure by manipulating the expression of glucosyltransferase into the Golgi apparatus. This process first needs not only functional expression of GnT I in the initial or intermediate Golgi apparatus but also needs to ensure sufficient supply of UDP-GlcNAc.
[90] Integration location
[91] Since the ultimate goal of this genetic engineering effort is a powerful protein producing strain that can perform well in industrial fermentation processes, the integration of multiple genes into fungal chromosomes is associated with thoughtful planning. The engineered strain should be transformed with a range of different genes, and these genes should be transformed in a stable manner so that the desired activity is maintained throughout the fermentation process. Any combination of enzyme activities described below will have to be engineered into fungal protein expression hosts: sialyltransferase, mannosidase, fucosyltransferase, galactosyltransferase, glucosyltransferase, GlcNAc transferase, ER and Golgi Specificity transporters (eg, sym and antiport transporters for UDP-galactose and other precursors), other enzymes involved in the processing of oligosaccharides, and activation such as UDP-galactose, CMP-N-acetylneuraminic acid Enzymes involved in the synthesis of oligosaccharide precursors. At the same time, a number of genes encoding enzymes known to be characteristic of nonhuman glycosylation reactions will have to be deleted.
[92] Targeting Glycosyltransferases to Specific Organs
[93] Glycosyltransferases and mannosidases lining the inner (luminal) surface of the ER and Golgi apparatus, allowing for "sequenced" processing of the glycoproteins as they pass through the ER and Golgi network. To provide. Multiple compartments of the cis, intermediate and trans Golgi and Trans Golgi networks (TGN) provide different locations where ordered glycosylation reactions can occur. As the glycoprotein progresses from synthesis in ER to complete maturation in late Golgi or TGN, it can be exposed to different glycosidase, mannosidase and glycosyltransferase in the order specified to synthesize specific carbohydrate structures. have. Many efforts have been made to determine the exact mechanism by which these enzymes are maintained and fixed in their respective organs. Evolutionary explanations are complex, but provide evidence that the stem region, membrane stratification region, and cytoplasmic tail, respectively or in concert, localize the relevant catalytic domains in place by inducing enzymes to the membranes of individual organs.
[94] Targeting sequences is well known and described in various scientific literature and public databases, as described in detail in the Library section for targeting of sequences and selection of targeted enzymes.
[95] How to Create a Library That Generates Modified Glycosylation Pathways
[96] Libraries comprising two or more genes encoding exogenous glycosylated proteins are transformed into a host organism to produce a genetically mixed population. Subsequently, the transformants bearing the desired glycosylated phenotype are selected from the mixed population. In a preferred embodiment, the host organism is yeast, specifically blood. Pastoris, the host glycosylation pathway is modified by the functional expression of one or more human or animal glycosylation enzymes to produce protein N-glycans similar or identical to human glycoforms. In a particularly preferred embodiment, the DNA library comprises a genetic construct that encodes a glycosylation enzyme and a fusion with a targeting sequence specifically for various cell locations involved in glycosylation in ER, cis Golgi, intermediate Golgi, or trans Golgi. .
[97] Examples of modifications to glycosylation that can be made using this method include (1) manipulation of eukaryotic microorganisms to cleave mannose residues to produce Man ₅ GlcNAc ₂ as protein N-glycans from Man ₈ GlcNAc ₂ ; (2) manipulation of eukaryotic microorganisms to add N-acetylglucosamine (GlcNAc) residues to Man ₅ GlcNAc ₂ by the action of GlcNAc transferase I; (3) N-acetylglucosamine transferase (GnT I, GnT II, GnT III, GnT IV, GnT V, GnT VI), mannosidase II, fucosyltransferase, galactosyl transferase (GalT) or sialyl Manipulation of eukaryotic microorganisms to functionally express enzymes such as transferase (ST).
[98] By repeating this method, more complex glycosylation pathways of increasing complexity can be engineered in the target microorganism. In one preferred embodiment, the host organism is transformed at least twice with a DNA library comprising a sequence encoding glycosylation activity. Selection of the desired phenotype can be performed after one round of transformation or after several rounds of transformation have occurred. Complex glycosylation pathways can be manipulated quickly in this manner.
[99] DNA library
[100] It is necessary to construct a DNA library comprising two or more exogenous genes encoding glycosylation enzymes. In addition to open reading frame sequences, it is generally desirable to provide respective library constructs that contain promoters, transcription terminators, enhancers, ribosomal binding sites, and other functional sequences to ensure efficient transcription and translation of the gene upon transformation into the host organism. desirable. When the host is Pchia pastoris, suitable promoters include, for example, AOX1 , AOX2 , DAS and P40 promoters. It is also desirable to provide each construct having one or more selectable markers, such as genes that confer drug resistance or genes that complement host metabolic disorders. The presence of such markers is useful for the selection of transformants to be subsequently performed: for example, URA3 , HIS4 , SUC2 , G418 , BLA or SH BLE genes can be used in the enzyme.
[101] In some cases, the library can be constructed directly from existing or wild type genes. However, in a preferred embodiment, the DNA library is constructed from the fusion of two or more sub libraries. By in-frame ligation of the sublibrary, it is possible to generate a number of novel gene constructs that encode useful targeted glycosylation activity. For example, any useful sublibrary may be a DNA sequence encoding any combination of enzymes such as sialyltransferase, mannosidase, fucosyltransferase, galactosyltransferase, glucosyltransferase, and GlcNAc transferase. It includes. The enzymes are preferably derived from humans, although other mammalian, animal or fungal enzymes are also useful. In a preferred embodiment, the gene is cleaved to produce fragments encoding the catalytic domains of the enzymes. By removing endogenous targeting sequences, the enzymes are reinduced and expressed into other cell locations. The selection of such catalyst domains can be made based on the knowledge of the specific environment in which the catalyst domains are subsequently activated. For example, if a particular glycosylation enzyme is active in the late Golgi, all known enzymes of the host organism in the late Golgi have any optimal pH, and then the catalytic domain is chosen to exhibit the appropriate activity at that pH. do.
[102] Another useful sublibrary includes DNA sequences encoding signal proteins that localize proteins to specific locations within the ER, Golgi or trans Golgi networks. These signal sequences are selected from the host organism as well as other related or unrelated organisms. Membrane binding proteins of ER or Golgi typically include, for example, an N-terminal sequence encoding the cytoplasmic tail (ct), transmembrane domain (tmd), and stem region (sr). The ct, tmd, and sr sequences are individually sufficient or associated to anchor the protein to the internal (luminal) membrane of the organ. Thus, preferred embodiments of sub-libraries of signal sequences include ct, tmd and / or sr sequences derived from these proteins. In some cases, it is desirable to provide a sublibrary with sr sequences of varying lengths. This can be done by PCR using primers that bind to the 5 'end of the DNA encoding the cytoplasmic region and using a series of opposing primers that bind to various parts of the stem region. Still other useful sources of signal sequences include search signal peptides, such as tetrapeptide HDEL or KDEL, which are typically identified at the C-terminus of the protein back transported into ER or Golgi. Still other sources of signal sequences include (a) type II membrane proteins, (b) enzymes listed in Table 3, (c) membrane-bound nucleotide sugar transporters localized within the Golgi, and (d) sequences listed in Table 5. It includes.
[103] Sources of Useful Compartment Target Sequences Gene or sequence organism function Location of gene products MnsIs. Cerebize α-1,2-mannosidase ER OCH1s. Cerebize 1,6-mannosyltransferase Golgi (cis) MNN2s. Cerebize 1,2-Mannosyltransferase Golgi (medium) MNN1s. Cerebize 1,3-mannosyltransferase Golgi (trans) OCH1blood. Pastoris 1,6-mannosyltransferase Golgi (cis) 2,6 ST H. Sapiens 2,6-sialyltransferase Trans Golgi Network UDT-Gal T s. Pomb UDP-Gal Transporter Golgi Mnt1s. Cerebize 1,2-Mannosyltransferase Golgi (cis) HDEL at C-terminal s. Cerebize Search signal ER
[104] In any case, it is desirable for the signal sequence to select a signal sequence suitable for the enzymatic activity or activities to be engineered into the host. For example, in the development of modified microorganisms capable of terminal sialation of neonatal N-glycans, it is desirable to use a sub library of signal sequences derived from late Golgi proteins. Similarly, cleavage of Man ₈ GlcNAc ₂ by α-1,2-mannosidase to produce Man ₅ GlcNAc ₂ is an early stage of complex N-glycan formation in humans. Thus, the reaction preferably occurs in the ER or early Golgi of the engineered host microorganism. A sub library is used to encode the ER and the initial Golgi retention signal.
[105] In a preferred embodiment, the DNA library is constructed by ligation in-frame a sub library comprising DNA encoding a signal sequence and a sub library comprising DNA encoding a glycosylation enzyme or catalytically active fragment thereof. The resulting library contains synthetic genes encoding fusion proteins. In some cases, it is desirable to provide a signal sequence at the N-terminus or otherwise at the C-terminus of the fusion protein. In some embodiments, the signal sequence can be inserted into the open reading frame of the enzyme, provided that the protein structure of the individual folded domains is not disrupted.
[106] The method is most effective when the DNA library transformed into the host contains a wide variety of sequences, thereby increasing the probability that one or more transformants will exhibit the desired phenotype. Thus, prior to transformation, the DNA library or constitutive sublibrary can perform one or more gene shuffling, error prone PCR or in vitro mutagenesis rounds.
[107] Transformation
[108] The DNA library is then transformed into a host organism. In yeast, any useful DNA delivery method can be used, such as electroporation, lithium chloride, or spheroplast. In order to produce strains suitable for high density fermentation, it is desirable to integrate the DNA library into the host chromosome. In a preferred embodiment, integration occurs by homologous recombination using techniques known in the art. For example, a DNA library element has a contiguous sequence that is homologous to the sequence of the host organism. In this manner, integration occurs at defined locations in the host organism, with no disruption of the desired or essential genes. In a particularly preferred embodiment, the library DNA is integrated into an undesirable position in the host organism, resulting in disruption or deletion of the gene. For example, integration into the position of the OCH1, MNN1 or MNN4 genes allows for the expression of the desired library DNA while preventing the expression of yeast involved in overnorsylation of glycoproteins in yeast. In other embodiments, library DNA can be introduced by random integration into chromosomes, plasmids, retroviral vectors, or host genomes. In any case, it is desirable to include one or more selectable marker genes with each library DNA construct to enable ready selection of stably transformed host organisms. Particularly suitable are the recyclable marker genes, for example ura3 , which can be selected for or for the marker gene.
[109] Selection process
[110] After transformation of the host strain with the DNA library, the transformants that exhibit the desired glycosylation phenotype are selected. The selection can be carried out by a single step or by a series of phenotypic enrichment and / or depletion using any of a variety of analytical or detection methods. Phenotypic characterization can be performed manually or using automated high throughput screening equipment. Typically, host microorganisms display protein N-glycans on the cell surface, where various glycoproteins are localized. Thus, intact complete cells can be screened for the desired glycosylation phenotype by exposing the cells to lectins or antibodies that specifically bind the desired N-glycans. Various oligosaccharide specific lectins are commercially available (California San Mateoi EY Laboratories). In addition, antibodies to certain human or animal N-glycans are commercially available or can be prepared by standard techniques. Suitable lectins or antibodies can be conjugated to reporter molecules such as chromophores, fluorophores, radioisotopes or enzymes having chromogenic substrates. Guillen et al., 1998, Proc. Natl. Acad. Sci. USA 95 (14): 7888-7892]. Screening can then be performed using analytical methods such as spectrophotometry, fluorometry, fluorescence activated cell sorting, or scintillation counting. In other cases, it may be necessary to analyze glycoproteins or N-glycans isolated from the transformed cells. Protein isolation can be performed using techniques known in the art. If isolated N-glycans are desired, enzymes such as endo-β-N-acetylglucosaminidase (Massachusetts Boston Genzyme Company) can be used to cleave N-glycans from glycoproteins. The isolated protein or N-glycan can then be analyzed using liquid chromatography (eg, HPLC), mass spectrophotometry, or other suitable means. US Pat. No. 5,595,900 teaches several methods for identifying cells that possess the desired extracellular carbohydrate structure. It is desirable to eliminate the population of transformed cells that possess an undesirable phenotype prior to the selection of the desired transformants. For example, when manipulating functional mannosidase activity into cells using this method, the transformants of interest will have low levels of mannose in the cellular glycoprotein. Exposure of the transformed population to the lethal radioisotope of mannose in the medium can eliminate the population of transformants having an undesirable phenotype, i.e., transformants with high levels of incorporated mannose. Alternatively, cytotoxicity or antibodies induced against undesirable N-glycans can be used to remove transformed populations of undesirable phenotypes.
[111] How to provide sugar nucleotide precursors to the Golgi apparatus
[112] For glycosyltransferases that function satisfactorily in the Golgi, the enzyme needs to have a sufficient concentration of suitable nucleotide sugars, which are high energy donors of the sugar moiety added to the neoglycoprotein. For suitable compartments these nucleotide sugars are provided by expressing an exogenous gene encoding a sugar nucleotide transporter in the host organism. The choice of transporter enzyme is influenced by the properties of the exogenous glycosyltransferases used. For example, GlcNAc transferases require UDP-GlcNAc transporters, fucosyltransferases require GDP-fucose transporters, galactosyltransferases require UDP-galactose transporters, or Sialyltransferases may require CMP-sialic acid transporters.
[113] The added transporter protein carries nucleotide sugars from the cytoplasm to the Golgi apparatus, where the nucleotide sugars can react with glycosyltransferases to elongate, for example, N-glycans. The reaction liberates nucleoside diphosphates or monophosphates such as UDP, GDP or CMP. Since accumulation of nucleoside diphosphate inhibits the further activity of glycosyltransferase, it is often desirable to provide an expressed copy of a gene encoding nucleotide dephosphatase. The diphosphatase (suitably specific for UDP or GDP) hydrolyzes diphosphonucleosides to yield nucleoside monophosphates and inorganic phosphates. Nucleoside monophosphate does not inhibit glycosyltransferases and in some cases is released from the Golgi by an endogenous cellular system. Suitable transporter enzymes of mammalian origin are described below.
[51] Summary of the Invention
[52] Cells with genetically modified glycosylation pathways have been developed that allow cell lines to carry out a sequence of enzymatic reactions that mimic the processing of glycoproteins in humans. Recombinant proteins expressed in these genetically engineered hosts produce glycoproteins that are more similar to their human glycoproteins (if not substantially identical). Lower eukaryotes that produce high mannose, usually containing N-glycans, such as unicellular and multicellular fungi, such as Pchia pastoris, Hansenula polymorpha, Pchia stetistis, Pchia methanolica, The genus Pchia, genus Kluyveromyces, Candida albicans, Aspergillus nidulans and Trichoderma reesei are modified to produce N-glycans or other structures such as Man ₅ GlcNAc ₂ along the human glycosylation pathway. It is possible to obtain strains that do not express specific enzymes that produce undesirable complex structures characteristic of fungal glycoproteins, strains that express exogenous enzymes selected to have optimal activity under conditions present in the fungus in which activity is desired or optimal activity is obtained. Acquired in combination with the selection and / or manipulation of a host expressing an exogenous enzyme selected to be targeted to an organ and combinations thereof, wherein the genetically engineered eukaryotes are required to produce a number of exogenous enzymes necessary to produce a “human-like” glycoprotein. Expresses.
[53] In a first embodiment, the microorganism is engineered to express an exogenous α-1,2-mannosidase enzyme having an optimal pH of 5.1 to 8.0, preferably 5.9 to 7.5. In another preferred embodiment, the exogenous enzyme is targeted to the endoplasmic reticulum or Golgi apparatus of the host organism, which cleaves N-glycans such as Man ₈ GlcNAc ₂ to produce Man ₅ GlcNAc ₂ . The latter structure is useful because it is identical to the structure formed in mammals, especially humans, and it is in vivo and / or tested to produce a finished N-glycan similar or identical to that formed in mammals, especially humans. It is a substrate for further glycosylation reactions in the tube; This is because it is not a substrate for the overmanosylation reaction occurring in vivo of other microorganisms and enzymes that make glycoproteins highly immunogenic in animals.
[54] In a second embodiment, the glycosylation reaction of the eukaryotic microorganism comprises (a) a DNA library comprising two or more genes encoding exogenous glycosylation enzymes; (b) transforming the microorganism with the library to generate a genetically mixed population expressing two or more distinct exogenous glycosylation enzymes; (c) is modified by selecting a microorganism having the desired glycosylation phenotype from said population. In a preferred embodiment, the DNA library comprises a catalytic activity for glycosylation and a chimeric gene, each encoding a protein localization sequence. Organisms modified in this manner are useful for producing glycoproteins having a glycosylation pattern similar or identical to mammals, especially humans.
[55] In a third embodiment, the glycosylation pathway is modified to express the sugar nucleotide transporter enzyme. In a preferred embodiment, the nucleotide dephosphatase enzyme is also expressed. Transporters and diphosphatases improve the efficiency of the engineered glycosylation step, which provides a suitable substrate for glycosylation enzymes in suitable compartments, reduces competitive product inhibition, and eliminates nucleoside dephosphatase. By promoting it.
[114] Example 1: Blood with α-1,2-mannosidase to produce insulin. Manipulation of Paris Story
[115] α-1,2- manno let agent is required to produce a necessary intermediate in Man ₅ GlcNAc ₂ to Man ₈ GlcNAc ₂ for cutting the complex N- glycan formation. OCH1 mutant strains of P. pastoris were engineered to express secreted human interferon-α under the control of the aox promoter. The DNA library was constructed by in-frame ligation of a sublibrary comprising a catalytic domain of human mannosidase IB (α-1,2-mannosidase) and a sequence encoding an initial Golgi localized peptide. The DNA library is then transformed into a host organism to form a genetically mixed population, where each transformant expresses a synthetic mannosidase gene from the library as well as interferon-β, respectively. Individual transformant colonies were cultured and a population of interferons was induced by addition of metalols. Under these conditions, at least 90% of the secreted protein contained interferon-β. The supernatant was purified by C ₁₈ silica reversed phase chromatography to remove salts and low molecular weight contaminants. The desired transformant expressing the appropriately targeted active α-1,2-mannosidase produces an interferon-β comprising N-glycans of the Man ₅ GlcNAc ₂ construct, whose molecular weight is dependent on the interferon of the parental strain. Compared with the decrease. Purified supernatants containing interferon-β were analyzed by MALDI-TOF mass spectrophotometry to identify colonies expressing the desired form of interferon-β.
[116] Example 2: Manipulation of Strains Expressing GlcNAc Transferase I
[117] GlcNAc transferase I activity was required for maturation of complex N-glycans. Man ₅ GlcNAc ₂ can only be cleaved by mannosidase II, which is a necessary step in the formation of human glycoforms which occur after addition of GlcNAc to the terminal α-1,3 mannose residues by GlcNAc transferase I Schachter, 1991 Glycobiology 1 (5): 453-461. Thus, libraries are prepared to contain DNA fragments encoding appropriately targeted GlcNAc transferase I genes. The host organism is a strain, for inde example yeast, only with nosil painter's lack (e.g., OCH1 mutant), corrugated and / or provided the substrate UDP-GlcNAc in the ER and the Golgi and / or a Man ₅ in the ER Provides N-glycans of GlcNAc ₂ structure. After transformation of the host using the DNA library, the transformants screen for having the highest concentration of terminal GlcNAc on the cell surface, or secrete the protein with the highest content of terminal GlcNAc. This screening was performed using cigar methods (eg, staining techniques), specific terminal GlcNAc binding antibodies, or lectins. Alternatively, the transformants of interest reduced the binding of certain lectins specific for terminal mannose residues.
[118] Example 3: Manipulation of Strains Using Mannosidase II
[119] In another example, it is desirable to remove two remaining terminal mannose from the GlcNAcMan ₅ GlcNAc ₂ structure by the action of mannosidase II to produce human glycoforms in the microorganism. Preferably, the DNA library comprising the sequences encoding the cis and intermediate Golgi localization signals is fused to the library encoding the mannosidase II catalytic domain in frame. Host organisms are strains, for example yeast, which are strains lacking overmanosylation (eg, OCH1 mutants) and provide N-glycans with GlcNAcMan ₅ GlcNAc ₂ structures in the Golgi and / or ER do. After transformation, organisms with the desired glycosylation phenotype were selected. In one method an in vitro assay was used. The desired construct GlcNAcMan ₃ GlcNAc ₂ (GlcNAcMan ₅ GlcNAc ₂ is not preferred) is the substrate of the enzyme GlcNAc transferase II. Thus, single colonies can be analyzed using the enzyme in vitro in which the substrate UDP-GlcNAc is present. Release of UDP can be determined by enzymatic analysis for HPLC or UDP. Alternatively, radiolabeled UDP-GlaNAc was used.
[120] The in vitro analysis described above was readily performed on individual colonies using high throughput screening equipment. Alternatively, lectin binding assays were used. In this case, reduced binding of lectins specific for terminal mannose enabled selection of transformants with the desired phenotype. For example, the Galantus nivalis lectin specifically binds to terminal α-1,3-mannose, the concentration of which decreased in the presence of operably expressed mannosidase II activity. In one suitable method, attached to a solid agarose support. Nivalis lectin was used to degenerate the transformed population of cells with high levels of terminal α-1,3-mannose.
[121] Example 4 Manipulation of Organisms Expressing Sialyltransferase
[122] The enzymes α-2,3-sialyltransferase and α-2,6-sialyltransferase add terminal sialic acid to galactose residues in neonatal human N-glycans to induce mature glycoproteins. In humans, the reaction occurs in trans Golgi or TGN. Thus, the DNA library is constructed by in-frame fusion of a sequence encoding a sialyltransferase catalytic domain with a sequence encoding a trans Golgi or TGN localization signal. Host organisms are strains, for example yeast, which are strains (e.g., OCH1 mutants) lacking hypermanosylation, which provide N-glycans having terminal galactose residues in tnas Golgi or TGN Provide sufficient concentrations of CMP-sialic acid in trans Golgi or TGN. Following transformation, the transformants carrying the desired phenotype are selected using fluorescent antibodies specific for N-glycans carrying terminal sialic acid.
[123] Example 5 Method of Manipulating Strains Expressing UDP-GlcNAc Transporter
[124] The cDNA of the human Golgi UDP-GlaNAc transporter was cloned by Ishida and its co-workers (Ishida, N. et al., 1999, Biochem. 126 (1): 68-77]. Guillen and its co-workers cloned the dog kidney Golgi UDP-GlaNAc transporter by phenotypic correction of Glugi Veromyses lactis mutants lacking Golgi UDP-GlcNAc (Guillen, E. et al., 1998). Thus, the mammalian Golgi UDP-GlcNAc transporter gene has all the necessary information about the protein to be functionally expressed and targeted to the Golgi apparatus of yeast.
[125] Example 6: Operation of strains expressing GDP-fucose transporter
[126] Rat liver Golgi membrane GDP-fucose transporters have been identified and purified by Puglielli, L. and C. B. Hirschberg. Puglielli, L. and C. B. Hirschberg, 1999, J. Biol. Chem. 274 (50): 35596-35600. Corresponding genes can be identified using standard techniques such as Southern blotting using N-terminal sequences and degenerate DNA probes. The intact gene can then be expressed in a host microorganism expressing fucosyltransferase.
[127] Example 7: Operation of strains expressing UDP-galactose transporter
[128] Human UDP-galactose transporters have been identified, S. It is known to be active in cerevises (Kainuma, M. et al., 1999 Glycibiology 9 (2): 133-141). The second human UDP-galactose transporter (hUGT1) has been cloned and gimmickily expressed in Chinese hamster egg cells (Aoki, K. et al., 1999, J. BioChem. 126 (5): 940-950. Similarly, Segawa and its co-workers cloned the UDP-galactose transporter from the ski investigation Caromyces pombe (Segawa, H. et al., 1999, Febs Letters 451 (3): 295-298).
[129] CMP-sialic acid transporter
[130] Human CMP-sialic acid transporter (hCST) was cloned by Aoki and its co-workers and expressed in Lec 8 CHO cells (1999). In addition, molecular cloning of hamster CMP-sialic acid transporters has also been made. See Eckhardt and Gerardy Schahn 1997 Eur.J. Biochem. 248 (1): 187-192]. The donor expression of the murine CMP-sialic acid transporter was made in Saccharomyces cerevises by Berninsone. Berninsone, P. et al., 1997 J. Biol. Chem. 272 (19): 12616-12619]
[131] Preferred embodiments of the method for modifying glycosylation in eukaryotic microorganisms such as Peachia pastoris Desired structureSuitable for catalytic activityAppropriate Source of Localization SequenceSuitable gene deletionSuitable transporters and / or phosphatase Man ₅ GlcNAc ₂ α-1,2-mannosidase (murine, human, genus Bacillus, A. nidulans)Mns1 (N-terminus, S. cerevise) Och1 (N-terminus, S. cerevise, P. pastoris) Ktr1 Mnn9Mnt1 (S. cerevisiae) KDEL, HDEL (C-terminus)OCH1MNN4MNN6None GlcNAcMan ₅ GlcNAc ₂ GlcNAc Transferase I (Human, Rat, Rat, etc.)Och1 (N-terminal, S. cerevise, P. pastoris) KTR1 (N-terminal) KDEL, HDEL (C-terminal) Mnn1 (N-terminal, S. cerevise) Mnt1 (N-terminal, S. cereze) BP) GDPase (N-terminus, S. cerebize)OCH1MNN4MNN6UDP-GlcNAc Transporter (Human, Rat, K. Lactis) UDPP (Human) GlcNAcMan ₃ GlcNAc ₂ Mannosidase IIKtr1 Mnn1 (N-terminus, S-Serevise) Mnt1 (N-terminus, S. Cerevise) Kre2 / Mnt1 (S. Cervise) Kre2 (P. Pastoris) Ktr1 (S. Cerevise) Ktr1 (P. Pas. Torres) Mnn1 (S. cerevije)OCH1MNN4MNN6UDP-GlcNAc Transporter (Human, Rat, K. Lactis) UDPP (Human)
[132] Preferred embodiments of the method for modifying glycosylation in eukaryotic microorganisms such as Peachia pastoris Desired structureSuitable for catalytic activityAppropriate Source of Localization SequenceSuitable gene deletionSuitable transporters and / or phosphatase GlcNAc _(2-4) Man ₃ GlcNAc ₂ GlcNAc transferases II, III, IV, V (human, murine)Mnn1 (N-terminus, S. cerevise) Mnt1 (N-terminus, S. cerevisiae) Kre2 / Mnt1 (S. cerevisa) Kre2 (P. pastoris) Ktr1 (S. cerevise) Ktr1 (P. pas Torres) Mnn1 (S. cerevije)OCH1MNN4MNN6UDP-GlcNAc Transporter (Human, Rat, K. Lactis) UDPP (Human) Gal _(1-4) GlcNAc _(2-4) -Man ₃ GlcNAc ₂ β-1,4-galactosyl transferase (human)Mnn1 (N-terminus, S. cerevise) Mnt1 (N-terminus, S. cerevisiae) Kre2 / Mnt1 (S. cerevisa) Kre2 (P. pastoris) Ktr1 (S. cerevise) Ktr1 (P. pas Torres) Mnn1 (S. cerevije)OCH1MNN4MNN6UDP-galactose transformers (human, S. form) NANA _(1-4) -Gal _(1-4) GlcNAc _(2-4) -Man ₃ GlcNAc ₂ α-2,6-sialyl transferase (human) α-2,3-sialyl transferaseKTR1 Mnn1 (N-terminus, S-Serevise) MNT1 (N-terminus, S. Cerevise) Kre2 / Mnt1 (S. Cervise) Kre2 (P. Pastoris) Ktr1 (S. Cerevise) Ktr1 (P. Pas. Torres) MNN1 (S. cerevije)OCH1MNN4MNN6CMP-sialic acid transporter (human)
[133] Table 7
[134] DNA and protein sequence data
[135] 1. The European Bioinformatics Institute (EBI) is a research and service center within bioinformatics: http://www.ebi.ac.uk/
[136] 2. Swissprot Database: http://www.expasy.ch/spr
[137] 3. List of Known Glycosyltransferases and Their Origin
[138] β1,2 /// 8GnT I) EC 2.4.1.101
[139] 4. Human cDNA, Kumar et al. (1990) Proc. Natl.Acad.Sci. USA 87: 9948-9952
[140] 5. Human genes, Hull et al. (1991) Biochem. Biophys. Res. Commun. 176: 608-615
[141] 6. Mouse cDNA, Kumar et al. (1992) Glycobiology 2: 383-393
[142] 7. Mouse Gene, Pownall et al. (1992) Genomics 12: 699-704
[143] 8. Murine genes (5 'flanking, non-coding), Yang et al. (1994) Glycobiology 5: 703-712
[144] 9. Rabbit cDNA, Sarkar et al. (1991) Proc. Natl. Acad. Sci. USA 88: 234-238
[145] 10. Rat cDNA, Fukada et al. (1994) Biosci. Biotechnol. Biochem. 58: 200-201
[146] 1,2 (GnT II) EC 2.4.1.143
[147] 11. Human genes, Tan et al. (1995) Eur. J. Biochem. 231: 317-328
[148] 12. Rat cDNA, D'Agostaro et al. (1995) J. Biol. Chem. 270: 15211-15221
[149] β1,4 (GnT III) EC 2.4.1.144
[150] 14. cDNA, Ihara et al. (1993) J. Biochem. 113: 692-698
[151] 15. Murine Gene, Bhaumik et al. (1995) Gene 164: 295-300
[152] 16. Rat cDNA, Nishikawa et al. (1992) J. Biol. Chem. 267: 18199-18204
[153] β1,4 (GnT IV) EC 2.4.1.145
[154] 17. Human cDNA, Yoshida et al. (1998) Glycoconjugate Journal 15: 1115-1123
[155] 18. Bovine cDNA, Minowa et al., Eurpoean Patent EP 0 905 232
[156] β1,6 (GnT V) EC 2.4.1.155
[157] 19. Human cDNA, Saito et al. (1994) Biochem. Biophys. Res. Commun. 198: 318-327
[158] 20. Rat cDNA, Shoreibah et al. (1993) J. Biol. Chem. 268: 15381-15385
[159] β1,4 galactosyltransferase, EC 2.4.1.90 (LacNAc synthase) EC
[160] 2.4.1.22 (lactose synthase)
[161] 21. Bovine cDNA, D'Agostaro et al. (1989) Eur. J. Biochem. 183: 211-217
[162] 22. Bovine cDNA (partial), Narimatsu et al. (1986) Proc. Natl. Acad. Sci.
[163] USA 83: 4720-4724
[164] 23. Bovine cDNA (partial), Masibay & Qasba (1989) Proc. Natl. Acad. Sci.
[165] USA 86: 5733-5377
[166] 24. Bovine cDNA (5 'end), Russo et al. (1990) J. Biol. Chem. 265: 3324
[167] 25. Chicken cDNA (partial), Ghosh et al. (1992) Biochem. Biophys. Res.
[168] Commun. 1215-1222
[169] 26. Human cDNA, Masri et al. (1988) Biochem. Biophys. Res. Commun. 157: 657-663
[170] 27. Human cDNA, (HeLa cells) Watzele & Berger (1990) Nucl. Acids Res. 18: 7174
[171] 28. Human cDNA, (partial) Uejima et al. (1992) Cancer Res. 52: 6158-6163
[172] 29. Human cDNA, (carcinoma) Appert et al. (1986) Biochem. Biophys. Res. Commun. 139: 163-168
[173] 30. Human genes, Mengle-Gaw et al. (1991) Biochem. Biophys. Res. Commun. 176: 1269-1276
[174] 31. Murine cDNA, Nakazawa et al. (1988) J. Biochem. 104: 165-168
[175] 32. Murine cDNA, Shaper et al. (1988) J. Biol. Chem. 263: 10 420-10428
[176] 33. Rat cDNA (novel), Uehara & Muramastsu unpublished
[177] 34. Murine genes, Hollis et al. (1989) Biochem. Biophys. Res. Commun. 162: 1069-1075
[178] 35. Rat protein (partial), Bendiak et al. (1993) Eur. J. Biochem. 216: 405-417
[179] 2,3-sialyltransferase, (ST3Gal II) ( N(Connection) (Gal-1,3 / 4-GlcNAc) ED 2.4.99.6
[180] 36. Human cDAN, Kitagawa & Paulson (1993) Biochem. Biophys. Res. Commun.
[181] 194: 375-382
[182] 37. Rat cDNA, Wen et al. (1992) J. Biol. Chem. 267: 21011-21019
[183] 2,6-sialyltransferase, (ST6Gal I) EC 2.4.99.1
[184] 38. Chickens, Kurosawa et al. (1994) Eur. J. Biochem 219: 375-381
[185] 39. Human cDNA (partial), Lance et al. (1989) Biochem. Biophys. Res.
[186] Commun. 164: 225-232
[187] 40. Human cDNA, Grundmann et al. (1990) Nucl. Acids Res. 18: 667
[188] 41. Human cDNA, Zettlmeisl et al. (1992) Patent EPO475354-A / 3
[189] 42. Human cDNA, Stamenkovic et al. (1990) J. Exp. Med. 172: 641-643 (CD75)
[190] 43. Human cDNA, Bast et al. (1992) J. Cell Biol. 116: 423-435
[191] 44. Human gene (partial), Wang et al. (1993) J. Biol. Chem. 268: 4355-4361
[192] 45. Human gene (near 5 ′), Aasheim et al. (1993) Eur. J. Biochem. 213: 467-475
[193] 46. Human Gene (Promoter), Aas-Eng et al. (1995) Biochim. Biophys. Acta
[194] 1261: 166-169
[195] 47. Mouse cDNA, Hamamoto et al. (1993) Bioorg. Med. Chem. 1: 141-145
[196] 48. Rat cDNA, Weinstein et al. (1987) J. Biol. Chem. 262: 17735-17743
[197] 49. Rat cDNA (transcript fragment), Wang et al. (1991). Glycobiology 1: 25-31, Wang et al. (1990) J. Biol. Chem. 265: 17849-17853
[198] 50. Rat cDNA (5 'end), O'Hanlon et al. (1989) J. Biol. Chem. 264: 17389-17394; Wang et al. (1991) Glycobiology 1: 25-31
[199] 51. Rat gene (promoter), Svensson et al. (1990) J. Biol. Chem. 265: 20863-20688
[200] 52. Rat mRNA (fragment), Wen et al. (1992) J. Biol. Chem. 267: 2512-2518
[201] Additional methods and reagents that can be used in the methods for modifying glycosylation are described in the literature, for example in US Pat. Nos. 5,955,422, 4,775,622, 6,017,743, 4,925,796, 5,766,910, 5,834,251, 5,910,570 5,849,904, 5,955,347, 5,962,294, 5,135,854, 4,935,349, 5,707,828 and 5,047,335.
[202] Suitable enzyme expression systems can be obtained from sources such as the US Phenomena Culture Collection, Rockville, MD. Vector is available from many companies.

权利要求:
Claims (34)
[1" claim-type="Currently amended] A method for producing a glycoprotein having a carbohydrate structure similar to that produced by human cells in lower eukaryotes,
Providing a unicellular or multicellular fungal host that does not express one or more enzymes involved in the production of high mannose structures; And
Introducing at least one enzyme into the host to produce a carbohydrate structure selected from the group consisting of Man ₅ GlcNAc ₂ , Man ₈ GlcNAc ₂ and Man ₉ GlcNAc ₂ , wherein the enzyme is a host from which the carbohydrate structure is produced. Selecting to be targeted to a subcellular location in the host that will retain optimal activity at the pH at the location or retain optimal activity to produce a carbohydrate structure
How to include.
[2" claim-type="Currently amended] The method of claim 1, wherein said host lacks the activity of at least one enzyme selected from the group consisting of mannosyltransferases and phosphomannosyltransferases.
[3" claim-type="Currently amended] The method of claim 2, wherein the host does not express an enzyme selected from the group consisting of 1,6-mannosyltransferase, 1,3-mannosyltransferase and 1,2-mannosyltransferase. .
[4" claim-type="Currently amended] The method of claim 1, wherein the host is Pichia pastoris , Pichia finlandica , Pichia trehalophila , Pichia koclamae , Pichia Pichia membranaefaciens , Pichia opuntiae , Pichia thermotolerans , Pichia salictaria , Pichia guercuum , Pichia pijperi , Pichia stiptis , Pichia methanolica , Pichia sp. , Saccharomyces cerevisiae , Saccharomyces Genus Saccharomyces sp. , Hansenula polymorpha , Kluyveromyces sp. , Candida albicans , Aspergillus nidulans and Trichoder. ma reesei ).
[5" claim-type="Currently amended] The method of claim 2, wherein the host is blood. The OCH1 mutant of Pastoris.
[6" claim-type="Currently amended] The method comprises the step of introducing the Man ₈ GlcNAc ₂ or Man ₉ GlcNAc ₂ 1 or more manno let nucleotide molecule encoding the second involving the production of Man ₅ GlcNAc ₂ from into a host according to claim 1.
[7" claim-type="Currently amended] The method according to claim 6, wherein the optimum pH of the at least one mannosidase is within 1.4 pH units of the average optimal pH of the other representative enzymes in the organ where the mannosidase is localized, or has optimal activity at pH 5.1 to 8.0 How.
[8" claim-type="Currently amended] 8. The method of claim 7, wherein said mannosidase enzyme retains optimal activity at pH 5.9 to 7.5.
[9" claim-type="Currently amended] The method of claim 8, wherein the mannosidase enzyme is α-1,2-mannosidase derived from mouse, human, Lepidoptera , Aspergillus nidulans or Bacillus.
[10" claim-type="Currently amended] The method of claim 1 comprising providing a host capable of forming a Man ₅ GlcNAc ₂ structure that exhibits GnT I activity and retains UDP-Gn transporter activity.
[11" claim-type="Currently amended] The method of claim 1 comprising providing a host that retains UDP specific diphosphatase activity.
[12" claim-type="Currently amended] The method of claim 1, wherein the step of injecting one or more enzymes selected from the group consisting of mannosidase, glycosyltransferase and glycosidase into the host, wherein the enzyme is an endoplasmic reticulum, early, middle and late Golgi or trans And targeted to the Golgi network.
[13" claim-type="Currently amended] The method of claim 12, wherein the mannosidase enzyme is significantly localized in the Golgi apparatus or endoplasmic reticulum.
[14" claim-type="Currently amended] The method of claim 12, wherein the enzyme is formed by in-frame ligation of a DNA fragment encoding a catalytic domain of the enzyme and a cellular target signal peptide, and a DNA fragment encoding a glycosylation enzyme or catalytically active fragment thereof. Localized by forming a fusion protein between chimeric localization regions encoded by one or more gene constructs.
[15" claim-type="Currently amended] 15. The enzyme according to claim 14, which is derived from an enzyme selected from the group consisting of mannosyltransferases, diphosphotases, proteases, GnT I, GnT II, GnT III, GnT IV, GnT V, GnT VI, GalT, FT and ST. Providing a chimeric localization region.
[16" claim-type="Currently amended] 15. The other representative of the organ of claim 14, wherein said enzyme is selected from the group consisting of GnT I, GnT II, GnT III, GnT IV, GnT V, GnT VI, GalT, fucosyltransferase and ST, wherein said enzyme is localized. Providing a catalytic domain encoding a glycosidase or glycosyltransferase that retains an optimal pH within 1.4 pH units of the average optimal pH of the enzyme, or retains optimal activity at pH 5.1 to 8.0. .
[17" claim-type="Currently amended] The method of claim 1, wherein the host is UDP-GlcNAc transferase, UDP-galactosyltransferase, GDP-fucosyltransferase, CMP-sialyltransferase, UDP-GlcNAc transporter, UDP-galactose transporter, GDP -Introducing a nucleotide molecule encoding at least one enzyme selected from the group of nucleoside sugar transporters consisting of a fucose transporter, a CMP-sialic acid transporter and a nucleotide dephosphatase.
[18" claim-type="Currently amended] 18. The method of claim 17, comprising genetically manipulating the fungal strain to remove UDP or GDP by the action of diphosphatase.
[19" claim-type="Currently amended] The method of claim 1, wherein the glycoprotein comprises N-glycans at least 27 mole% comprising less than six mannose residues.
[20" claim-type="Currently amended] The method of claim 1, wherein the glycoprotein comprises one or more sugars selected from the group consisting of galactose, sialic acid, and fucose.
[21" claim-type="Currently amended] The method of claim 1, wherein the glycoprotein comprises one or more oligosaccharide branches comprising a NeuNAc-Gal-GlcNAc-Man structure.
[22" claim-type="Currently amended] The method of claim 1, wherein the glycoprotein comprises N-glycans having less than 4 mannose residues.
[23" claim-type="Currently amended] The method of claim 1, wherein after separation from the host, one or more additional glycosylation or carboxylation reactions are performed on the glycoprotein in vitro.
[24" claim-type="Currently amended] The method of claim 1,
(a) providing a DNA library comprising two or more genes encoding exogenous glycosylation enzymes;
(b) transforming said host with said library to produce a genetically mixed population expressing two or more distinct exogenous glycosylation enzymes;
(c) selecting a host that produces the desired glycosylated phenotype from said population.
[25" claim-type="Currently amended] The method of claim 24, wherein said host is transformed two or more times with said library prior to selection of the desired glycosylation phenotype.
[26" claim-type="Currently amended] The method of claim 24, wherein the library comprises one or more wild type genes encoding glycosylation enzymes.
[27" claim-type="Currently amended] The method of claim 24, wherein the library comprises one or more synthetic genes encoding glycosylation enzymes.
[28" claim-type="Currently amended] The method of claim 24, wherein the library comprises one or more genes previously subjected to a technique selected from gene shuffling, in vitro mutagenesis and error-pron PCR.
[29" claim-type="Currently amended] The one or more genetic constructs of claim 24, wherein the library is formed by in-frame linkage of a DNA fragment encoding a cellular target signal peptide using a DNA fragment encoding a glycosylation enzyme or catalytically active fragment thereof. How to include.
[30" claim-type="Currently amended] The DNA fragment of claim 29, wherein said DNA fragment encodes an activity selected from the group consisting of mannosidase, UDP-GlcNAc transferase, UDP-galactosyltransferase and CMP-sialyltransferase, wherein said cellular target And the signal peptide significantly localizes the enzyme in an organ selected from the group consisting of endoplasmic reticulum, cis Golgi, intermediate Golgi and trans Golgi.
[31" claim-type="Currently amended] 25. The method of claim 24, wherein said selecting step retains specific affinity for mass spectrometry, liquid chromatography, cell characterization using fluorescence activated cell sorters, spectrophotometers, fluorometers or scintillation counters, and desired oligosaccharide moieties. Glycosylation by one or more methods selected from the group consisting of exposure of host cells to an antibody or lectin and exposure of cells to a cytotoxic molecule or radioactivity molecule selected from the group consisting of sugars, antibodies and lectins. Analyzing the protein or isolated N-glycan.
[32" claim-type="Currently amended] A host produced by the method of any one of claims 1-31.
[33" claim-type="Currently amended] A glycoprotein prepared by the method of any one of claims 1-31.
[34" claim-type="Currently amended] 31. The library of claims 24-30.

类似技术:

---

公开号 | 公开日 | 专利标题

---

JP2017060528A|2017-03-30|Glycosylation of molecule

---

US20190256883A1|2019-08-22|Method for producing glycoprotein having mannose residue as non-reducing end of sugar chain

---

KR101930961B1|2018-12-19|Method for increasing n-glycosylation site occupancy on therapeutic glycoproteins produced in pichia pastoris

---

Daly et al.2005|Expression of heterologous proteins in Pichia pastoris: a useful experimental tool in protein engineering and production

---

De Pourcq et al.2010|Engineering of glycosylation in yeast and other fungi: current state and perspectives

---

Idiris et al.2010|Engineering of protein secretion in yeast: strategies and impact on protein production

---

Tu et al.2010|Localization of Golgi-resident glycosyltransferases

---

Hamilton et al.2007|Glycosylation engineering in yeast: the advent of fully humanized yeast

---

US7094530B1|2006-08-22|α-1,3-fucosyltransferase

---

Li et al.2007|Expression of recombinant proteins in Pichia pastoris

---

US7872111B2|2011-01-18|Process for producing protein with reduction of acidic sugar chain and glycoprotein produced thereby

---

Maras et al.1999|Filamentous fungi as production organisms for glycoproteins of bio-medical interest

---

US5834251A|1998-11-10|Methods of modifying carbohydrate moieties

---

Jacobs et al.2009|N-glycosylation engineering of biopharmaceutical expression systems

---

Gleeson1998|Targeting of proteins to the Golgi apparatus

---

EP2365089B1|2014-05-14|Method of engineering a cytidine monophosphate-sialic acid synthetic pathway in yeast

---

AU2003238051B2|2008-03-13|Protein glycosylation modification in pichia pastoris

---

JP4787737B2|2011-10-05|Endomannosidase in glycoprotein modification in eukaryotes

---

US20150152427A1|2015-06-04|Method to engineer mammanlian-type carbohydrate structures

---

Jacobs et al.2009|Engineering complex-type N-glycosylation in Pichia pastoris using GlycoSwitch technology

---

US20100311122A1|2010-12-09|Vectors and yeast strains for protein production

---

US8741633B2|2014-06-03|Recombinant vectors

---

EP1211310B1|2006-12-13|Novel yeast variants and process for producing glycoprotein containing mammalian type sugar chain

---

Vervecken et al.2004|In vivo synthesis of mammalian-like, hybrid-type N-glycans in Pichia pastoris

---

Nasab et al.2013|A combined system for engineering glycosylation efficiency and glycan structure in Saccharomyces cerevisiae

同族专利:

---

公开号 | 公开日

---

US7981660B2|2011-07-19|

---

US20070178551A1|2007-08-02|

---

DK1297172T3|2006-02-13|

---

US8211691B2|2012-07-03|

---

US7923430B2|2011-04-12|

---

WO2002000879A2|2002-01-03|

---

AT309385T|2005-11-15|

---

AU2001276842B2|2007-04-26|

---

US7629163B2|2009-12-08|

---

US20070105127A1|2007-05-10|

---

DE60114830D1|2005-12-15|

---

US20060148035A1|2006-07-06|

---

US7326681B2|2008-02-05|

---

EP2322644A1|2011-05-18|

---

WO2002000879A3|2002-09-06|

---

CA2412701A1|2002-01-03|

---

EP2339013A1|2011-06-29|

---

US20160068880A1|2016-03-10|

---

US20020137134A1|2002-09-26|

---

EP1297172A2|2003-04-02|

---

EP2119793A1|2009-11-18|

---

ES2252261T3|2006-05-16|

---

US20110020870A1|2011-01-27|

---

US20130295604A1|2013-11-07|

---

AT440959T|2009-09-15|

---

ES2330330T3|2009-12-09|

---

JP2004501642A|2004-01-22|

---

US7029872B2|2006-04-18|

---

US20080274498A1|2008-11-06|

---

EP2339013B1|2014-07-02|

---

US20060177898A1|2006-08-10|

---

CY1109639T1|2014-08-13|

---

KR100787073B1|2007-12-21|

---

AU7684201A|2002-01-08|

---

EP1522590B1|2009-08-26|

---

DE60139720D1|2009-10-08|

---

US20120322100A1|2012-12-20|

---

US20100021991A1|2010-01-28|

---

NZ523476A|2004-04-30|

---

US20140234902A1|2014-08-21|

---

US20060078963A1|2006-04-13|

---

PT1522590E|2009-10-26|

---

DE60114830T2|2006-08-03|

---

JP2011167194A|2011-09-01|

---

EP1522590A1|2005-04-13|

---

EP1297172B1|2005-11-09|

---

MXPA03000105A|2004-09-13|

---

DK1522590T3|2009-12-21|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

法律状态:
2000-06-28|Priority to US21435800P

---

2000-06-28|Priority to US60/214,358

---

2000-06-30|Priority to US21563800P

---

2000-06-30|Priority to US60/215,638

---

2001-03-30|Priority to US27999701P

---

2001-03-30|Priority to US60/279,997

---

2001-06-27|Application filed by 글리코파이, 인크.

---

2001-06-27|Priority to PCT/US2001/020553

---

2003-04-21|Publication of KR20030031503A

---

2006-07-26|First worldwide family litigation filed

---

2007-12-21|Application granted

---

2007-12-21|Publication of KR100787073B1

优先权:

---

申请号 | 申请日 | 专利标题

---

US21435800P| true| 2000-06-28|2000-06-28|

---

US60/214,358|2000-06-28|

---

US21563800P| true| 2000-06-30|2000-06-30|

---

US60/215,638|2000-06-30|

---

US27999701P| true| 2001-03-30|2001-03-30|

---

US60/279,997|2001-03-30|

---

PCT/US2001/020553|WO2002000879A2|2000-06-28|2001-06-27|Methods for producing modified glycoproteins|